3 the search for a common progenitor of epcs and hpcs but does it really exist

Research Program of the Partnership for a New Generation of Vehicles doc

Ngày tải lên : 06/03/2014, 15:20

... Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and the ... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... charter of the National Academy of Sciences, as a parallel organization of outstanding engineers It is autonomous in its administration and in the selection of its members, sharing with the National...

134
466
0

A combinatorial approach to the search for anticonvulsant agents from gou teng and tian ma

Ngày tải lên : 11/09/2015, 21:27

... the fraction as a means of quality control, it would be too premature to regard it as an alkaloidal fraction since probably only a minor part of the extract was alkaloidal with non-alkaloidal constituents ... Instrumental analysis of the extracts 136 4.2.2.1 Qualitative analysis of the alkaloidal extract by LC-ESI-MS 136 4.2.2.2 Quantitative analysis of the alkaloidal extract by LC-DAD 137 4.2.2.3 Qualitative ... MVDA enables visualization and interpretation of patterns in correlating a sample variable with a target variable such as bioactivity Most of the times, the analysis of body fluids, such as blood,...

195
529
0

Báo cáo y học: "Resilience of refugees displaced in the developing world: a qualitative analysis of strengths and struggles of urban refugees in Nepal" docx

Ngày tải lên : 13/08/2014, 15:21

... , Kagwanja , Odiyo : Refugees in law and fact: A review of the literature and research agenda in Kenya Occasional Paper Series 2002, 1(1) Shrestha NM, Sharma B, Van Ommeren M, Regmi S, Makaju ... this capacity can actually be exercised; such opportunity for participation however, can only be taken advantage of if individuals have a certain social standard of living, which includes a minimum ... generally live clustered together and reside in cramped houses and apartments, and most have lived in Kathmandu for at least three years Criteria for participation included being a Somali or Pakistani...

11
373
0

Báo cáo hóa học: " Iterative algorithms for finding a common solution of system of the set of variational inclusion problems and the set of fixed point problems" potx

Ngày tải lên : 21/06/2014, 01:20

... doi:10.1186/1687-1812-2011-38 Cite this article as: Kangtunyakarn: Iterative algorithms for finding a common solution of system of the set of variational inclusion problems and the set of fixed point problems ... Nonlinear Convex Anal 7, 105–113 (2006) Kangtunyakarn, A, Suantai, S: Hybrid iterative scheme for generalized equilibrium problems and fixed point problems of finite family of nonexpansive mappings ... Math Anal Appl 248, 438–454 (2000) doi:10.1006/ jmaa.2000.6919 13 Noor, MA, Noor, KI: Sensitivity analysis for quasi-variational inclusions J Math Anal Appl 236, 290–299 (1999) doi:10.1006/jmaa.1999.6424...

16
309
0

carl sagan - the varieties of scientific experience--a personal view of the search for god

Ngày tải lên : 06/07/2014, 01:46

... sky, also has such a flattened disk of dust and maybe a little gas around it And many people think that it is in the final stages of sweeping up a solar nebula, that planets have already formed ... Andromeda And again we are looking at stars in the foreground within the Milky Way Galaxy, through which we are seeing M31 and two of its satellite galaxies Now, imagine that this is our galaxy ... is a commonplace in psychology and psychiatry And so it is with our view of the natural world Anthropologists and historians of religion sometimes call this animism and attribute it to so-called...

202
444
0

Báo cáo sinh học: "Search for a ‘Tree of Life’ in the thicket of the phylogenetic forest" doc

Ngày tải lên : 06/08/2014, 19:20

... simulations were performed by cutting the tree at random depth DR (DR < D0) and swapping a random pair of branches Additional data files Additional data file contains a list of species (59 bacterial ... vertical inheritance permeating the entire history of archaea and bacteria A contribution from ‘highways’ of HGT (that is, preferential HGT between certain groups of archaea and bacteria) that could ... used to analyze possible cases of HGT between bacteria and archaea in those trees that include at least five archaeal species and at least five bacterial species The value of the B /A score ranges...

17
440
0

Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Ngày tải lên : 05/09/2013, 09:08

... at the stage of planning and implementation of water and sanitation options Educational intervention on water and sanitation: 1995-1997 The educational intervention on water and sanitation was ... water and sanitation project in Bauniabad since 1993 The activities are divided into four phases: (i) Water and sanitation evaluation in 1993; (ii) Educational intervention on water and sanitation ... populated countries of the world, with a population of about 129 million in 2001(Bangladesh Bureau of Statistics, 2002) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban...

9
971
0

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Ngày tải lên : 14/02/2014, 19:20

... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed...

11
700
0

Tài liệu THE SEARCH FOR OBJECTIVE MEASURES OF AESTHETIC JUDGMENT: THE CASE OF MEMORY TRACES docx

Ngày tải lên : 19/02/2014, 17:20

... mean scores awarded to strong-trace and null-trace stimuli for the group of participants with art education Abbreviations for stimuli categories: RA = representational artistic, AA = abstract artistic, ... was a picture of similar content, same painter and period The distracter for each Abstract-Artistic target stimulus was a picture of same painter and period The distracter for each Representational-Decorative ... into account in the data analyses The choice of material and participants also deserves a brief remark First, much research in psychology of art has been carried out with simple materials, such as...

12
474
0

Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

Ngày tải lên : 07/03/2014, 01:20

... TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC TAGAATTCTTAATTTTTAGTATTTTCAGG TACATATGCACCATCACCATCACCATATTGTTACACCATATA TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC TAGAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC ... italics and the c-myc-encoding sequence is shown in bold Oligonucleotide Sequence (5Â- to 3Â) Restriction site -SpsB5 -SpsB3 tr-SpsB5 pIsaA5 IsaA3Myc TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC ... CBB-stained SDS PAGE gel and subsequently used in the in vitro assay Expression and purication of pre-IsaA Pre-IsaA (with a hexa-his-tag at the N-terminus and a c-Myc tag at the C-terminus) was...

13
464
0

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Ngày tải lên : 07/03/2014, 21:20

... larval development (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and ... interact with both BMPs and activins via its double extracellular ligand binding domains Such promiscuous behaviour has already been described for the Drosophila sax [42] and Caenohabditis elegans ... 5¢-TGAA ACCACAGCCTCAGTTG-3¢, where ‘s’ and a indicate sense and antisense primers, respectively Accurate ampliﬁcation of the target amplicon was checked by performing melt- 3437 BMP/activin pathway...

17
508
0

Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx

Ngày tải lên : 08/03/2014, 19:20

... and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and Technology NOAA National Oceanic and Atmospheric Administration NRC National ... and awards including: Alfred Noble Prize; Gzowski Medal and Duggan Medal and Prize, Engineering Institute of Canada; Golden Plate Award, American Academy of Achievement; International Award of ... capabilities for major storms, increased awareness of the vulnerability of certain types of structures, and taken steps to mitigate damage Despite these advances, the fatalities and damage from devastating...

49
588
0

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Ngày tải lên : 16/03/2014, 04:20

... towards its substrate Isothermal titration calorimetry (ITC) was used to compare the afﬁnity of CoA to wild-type thiolase and its C8 9A variant The results obtained (Fig and Table 3) indicate that ... determined and analysed: the structure of a complex of CoA with the C8 9A variant and a complex of CoA bound in the active site with an oxidized Cys89 The latter structure was obtained from a soaking ... Outstation ⁄ DESY The skillful technical assistance of Ville Ratas and discussions with Dr A M Lambeir (University of Antwerp, Belgium) and Dr Inari Kursula (University of Oulu, Finland) are gratefully...

13
472
0

Perfect symmetry the search for the beginning of time h pagels

Ngày tải lên : 17/03/2014, 14:03

... A schematic representation of the star-formation process out of a gravitationally contracting cloud of gas and dust A giant cloud located in a spiral arm of our galaxy fragments into ... outer space each second By using artificial satellites that can move through the solar wind and transmit back data about its activity, scientists hear the creaks, groans, screams, thunderclaps and ... farther perspective, we see that it is adorned with smaller satellite galaxies—the seven "dwarf galaxies" and Leo I and II, other small galaxies—in orbit about it In addition to these dwarf galaxies,...

460
278
0

The Fight for a Free Sea: A Chronicle of the War of 1812 pot

Ngày tải lên : 17/03/2014, 15:20

... streaming from the mizzen peak and main-topgallant mast, and a Union Jack at the fore The Java was adorned as bravely, and Captain Lambert had lashed an ensign in the rigging on the chance that ... friendly because of its opposition to an offensive warfare against Great Britain and an invasion of Canada Absorbed in the greater issue against Napoleon, England was nevertheless aroused to more ... was ready to attempt an invasion of Canada by way of Niagara The direct command was given to Major General Stephen Van Rensselaer of the New York State militia, who was to advance as soon as six...

76
440
0

The Heart of Grief Death and the Search for Lasting Love pptx

Ngày tải lên : 22/03/2014, 18:20

... Heart This page intentionally left blank Where Are They Now? But where is the part of Papa that loves me and you and Daddy? —Laura, age jive When her grandfather had a fatal heart attack, it was ... that she wanted to see him and be with Mommy and Daddy as much as possible Joanne barely relaxed when Laura asked a bit impatiently, "But where is the part of Papa that loves me and you and Daddy?" ... arouse pain and anguish as fresh memories and associations surface But the intensity is rarely as great or longlasting We can and relearn how to be and act at home and at ease, in ways old and new,...

310
871
0

The German Implementing Act for the AIFM Directive: A Critical Survey of the Draft Bill ppt

Ngày tải lên : 23/03/2014, 06:20

... in Kazakhstan are provided by the Almaty branch of Dechert Kazakhstan Limited A list of the names of the directors of Dechert Kazakhstan Limited is available for inspection at its registered office: ... (Re-)Introduction of the InvestmentAG With Fixed Capital The legal structure of the InvestmentAG with fixed capital is to a large extent identical to that of the InvestmentAG with variable capital: At its ... appropriately licensed — act as a management company of UCITS as well as of AIFs (and thus as AIFM) Since the conditions for granting a licence are regulated differently in the UCITSD and the AIFMD,...

13
514
0

Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot

Ngày tải lên : 29/03/2014, 18:20

... all financial transactions that fall under the same category pursuant to paragraph (a) and (b) Chapter III Payment of FTT, related obligations and prevention of evasion, avoidance and abuse Article ... avoidance and abuse: delegated acts and administrative cooperation in tax matters The risk of relocation are tackled by the choice of an appropriate set of tax rates and a broad definition of the taxable ... under HEADINGS to of the multiannual financial framework (Reference amount) (6) Commitments =4+ N /A N /A N /A N /A N /A N /A N /A N /A Payments =5+ N /A N /A N /A N /A N /A N /A N /A N /A Heading of multiannual...

31
569
0

Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc

Ngày tải lên : 30/03/2014, 11:20

... body fat and lean mass This has been shown to detect a range of 5–30% body fat mass with a correlation of 0.98 to values obtained by chemical analysis [49] The machine was calibrated before performing ... increased fat mass, as indicated by results of body composition analysis Our interpretation of these data is that chronic inhibition by B [a] P of physiological b-adrenergic and ACTH stimulation caused ... Irigaray et al conjunction of increased consumption of energy-rich food with decreased physical activity and common genetic variants [3] Obesity results from a large increase in fat mass or adipose...

11
424
0

The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

Ngày tải lên : 31/03/2014, 08:20

... that “gaseous stunning of broilers produced relatively better quality carcasses and meat than electrical stunning and therefore may have commercial advantages.” Specifically, gassed broilers had ... According to Anglia Autoflow’s sister company, American Autoflow, Inc., which serves North and South America, the “average price for an in-plant Easyload system fitted with gas stunning; washer; ... Animal Health and Animal Welfare (1998) agrees, writing that “ [a] nother advantage of gas stunning or gas killing methods, in comparison with electrical stunning, is that they may improve carcass...

16
504
0